Features of the Initiation of Translation of Two Plant Viral Messenger-Rnas
Browning, Karen Shive
This item is only available for download by members of the University of Illinois community. Students, faculty, and staff at the U of I may log in with your NetID and password to view the item. If you are trying to access an Illinois-restricted dissertation or thesis, you can request a copy through your library's Inter-Library Loan office or purchase a copy directly from ProQuest.
Permalink
https://hdl.handle.net/2142/67398
Description
Title
Features of the Initiation of Translation of Two Plant Viral Messenger-Rnas
Author(s)
Browning, Karen Shive
Issue Date
1980
Department of Study
Biochemistry
Discipline
Biochemistry
Degree Granting Institution
University of Illinois at Urbana-Champaign
Degree Name
Ph.D.
Degree Level
Dissertation
Keyword(s)
Chemistry, Biochemistry
Language
eng
Abstract
Wheat germ ribosomes combine with the AUG codon at positions 30-32 from the 5'-terminus of in vitro radioiodinated satellite tobacco necrosis virus (STNV) RNA to form initiation complexes that protect specific regions of the RNA from attack by ribonucleases. Wheat germ 80S ribosomes protect a "limit" region 19-52 nucleotides from the 5'-terminus. Wheat germ 40S ribosomes protect a "limit" region 10-47 nucleotides from the 5'-terminus. Characterization of the ribosome protected regions from ribonuclease attack establishes that wheat germ 40S and 80S ribosomes form initiation complexes with a linear conformation of STNV RNA lacking the proposed 5'-terminal loop and stem anticipated by Leung et al. {(1979) Biochemistry 18, 1361-1366}. The 5'-terminus of the small virion mRNA of the cowpea strain of tobacco mosaic virus (C(,c)-TMV) contains a m('7) (5')ppp(5')Gp... cap group. The 5'-terminal sequence of this RNA is m('7) G(5')ppp(5')GUAUUUGAUGAUGGCAUACUCGAUUCCGACUC^C(,C)AG(,C)...(' ). The codons following the consecutive AUGs match the N-terminal amino acid sequence of the coat protein of C(,c)-TMV. Wheat germ 80S ribosomes protect regions adjacent to the two consecutive AUGs from ribonuclease attack. Therefore one or both of the AUG sequences serve as sites for the initiation of translation of the small virion RNA of C(,c)-TMV.
Use this login method if you
don't
have an
@illinois.edu
email address.
(Oops, I do have one)
IDEALS migrated to a new platform on June 23, 2022. If you created
your account prior to this date, you will have to reset your password
using the forgot-password link below.